Ekaterina1234 Ekaterina1234 - 2 years ago 71
Java Question

Writing a method that calls a member variable

I want to find genes in a DNA string. Genes have START and STOP codons.

The start codon is ATG. The stop codons are: TGA, TAA, TAG.

This is an example of a DNA string:

In order to find a gene, we must find the start codon (ATG) and the closest stop codon (TAG, TGA or TAA), that is a multiple of 3 characters away from the start codon, so in this case the gene would be


and not




because TAG is 7 chars away from ATG and TGA, even though it's 12 chars away, it's not the closest STOP codon.

I am to write a method called printAll, with one parameter, String dna, that calls the findStopIndex member variable, which will be used to print all the genes found in a DNA String, such as this one:CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCA.

Here's the code I wrote so far:

public class ProteinFinder {
public void printAllStarts(String dna) {
int start = 0;
while (true) {
int loc = dna.indexOf("atg", start);
if (loc == -1) {
System.out.println("Starts at " + loc);
start = loc + 3;

public int findStopIndex(String dna, int index) {
int stop1 = dna.indexOf("tga", index);
if (stop1 == -1 || (stop1 - index) % 3!=0) {
stop1 = dna.length();

int stop2 = dna.indexOf("taa", index);
if (stop2 == -1 || (stop2 - index) %3 !=0) {
stop2 = dna.length();
int stop3 = dna.indexOf("tag", index);
if (stop3 == -1 || (stop3 - index) %3 !=0) {
stop3 = dna.length();
return Math.min(stop1, Math.min(stop2, stop3));
public void printAll(String dna) {


Could you help me write this method? Thank you.

Answer Source

This should work:

public void printAll(String dna) {
    int start = 0;
    while (true) {
        int atg = dna.indexOf("atg", start);
        if (atg == -1) {
        int end = findStopIndex(dna, atg+3);
        if (end != dna.length()) {
            System.out.println(dna.substring(atg, end+3));
            start = end + 3;
        else {
            start = start+3;
Recommended from our users: Dynamic Network Monitoring from WhatsUp Gold from IPSwitch. Free Download