Mohamed Ezzeddine Macherki Mohamed Ezzeddine Macherki - 7 months ago 34
R Question

number of occurence of two letters separted by a finit gap

Lets we have a string

of size
and contain
alphabet { A,B,C….}.
I have to perform a function that calculates number of occurrence of letter
which is separated with
letters (gap) form the letter

I=A, j=T and gap=10
That have to find the number of occurrence of AT,A-T,A--T,A---T,A----T,,,A---------T(- is any alphabet)

I used this code for DNA sequence (alphabet
=4) and suppose that is N(L*N)

inline const short int V (const char x){
case 'A':case 'a':
return 0;
case 'C':case 'c':
return 1;
case 'G':case 'g':
return 2;
return 3;


// [[Rcpp::export]]
IntegerVector basem(std::string seq ,int gap ,int N){
IntegerVector res(16);
short int x=0;
short int y=0;
for(int i=0;i<N-gap;i++){
return res;

// [[Rcpp::export]]
List basegap (std::string sequence,int x){
int n=sequence.size();
List result ;
for(int j=1;j<x;j++) {
return result;

basem:calculate the number of occurence for a gap

basegap: calculate the number of occurence for a gap from 1 to X

Running Example:

[1] "atgccatcactcagtaaagaagcggccctggttcatgaagcgttagttgcgcgaggactggaaacaccgctgcgcccgcccgtgcatgaaatggataacgaaacgccgaaaagccttattgctggtcatatgaccgaaatcatgcagctgctgaatctcgacctggctgatgacagtttgatggaaacgcggcatcgcatcgctaaaatgtatgtcgatgaaattttctccggtctggattacgccaatttcccgaaaatcaccctcattgaaaacaaaatgaaggtcgatgaaatggtcaccgtccgcgatatcactctgaccagcacctgtgaacaccattttgttaccatcgatggcaaagcgacggtggcctatatcccgaaagattcggtgatcggtctgtcaaaaattaaccgcattgtgcagttctttgcccagcgtccgcaggtgcaggaacgtctgacgcagcaaattcttgttgccgcgctacaaacgctgctgggcaccaataacgtggctgtctcgatcgacgcggtgcattactgcgtgaaggcgcgtggcatccgcgatgcaaccagtgccacgacaacgtcctctcttggtggattgttcaaatccagtcagaatacgcgccacgagtttctgcgcgctgtgcgtcatcacaactga"

[1] 40 50 42 37 47 46 36 49 45 39 44 39 38 42 45 28
[1] 61 38 23 48 48 39 57 35 44 58 28 38 17 44 60 33

[1] 42 47 43 38 42 49 53 35 44 44 35 44 42 39 37 36

[1] 50 39 44 37 35 53 44 47 46 41 47 33 39 46 32 36

[1] 42 54 36 38 54 36 52 36 43 49 41 34 31 39 38 45

[1] 40 50 42 37 47 46 36 49 45 39 44 39 38 42 45 28

[1] 42 44 40 42 45 44 44 45 38 44 47 38 44 45 36 28

[1] 38 44 44 42 44 49 42 42 40 44 42 41 47 40 39 27

[1] 34 48 47 38 46 49 41 41 47 39 39 42 42 40 40 31

[1] 43 37 45 42 40 46 56 34 45 57 33 32 40 36 33 44

[,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] [,9]
[1,] 61 42 50 42 40 42 38 34 43
[2,] 38 47 39 54 50 44 44 48 37
[3,] 23 43 44 36 42 40 44 47 45
[4,] 48 38 37 38 37 42 42 38 42
[5,] 48 42 35 54 47 45 44 46 40
[6,] 39 49 53 36 46 44 49 49 46
[7,] 57 53 44 52 36 44 42 41 56
[8,] 35 35 47 36 49 45 42 41 34
[9,] 44 44 46 43 45 38 40 47 45
[10,] 58 44 41 49 39 44 44 39 57
[11,] 28 35 47 41 44 47 42 39 33
[12,] 38 44 33 34 39 38 41 42 32
[13,] 17 42 39 31 38 44 47 42 40
[14,] 44 39 46 39 42 45 40 40 36
[15,] 60 37 32 38 45 36 39 40 33
[16,] 33 36 36 45 28 28 27 31 44

My questions are:

  1. How to reduce the complexity for this calculation?

  2. Are there any ideas to improve this code?


This can be done in O(N log N). The algorithm is as follows:

  1. Store the indexes of each letter i in a sorted manner. O(N)

  2. For every index with the letter j, binary search for the number of indexes of the letter i in the range. O(N log N)

In C++, this can be done by subtracting iterators. For example, in 1 iteration:

vector<int> indices;   <- Store indices of letter i
int index;   <- Index of a letter j
vector<int>:iterator it1 = upper_bound(indices.begin(),indices.end(),index+L);  <- Position just above the last index 
vector<int>:iterator it2 = lower_bound(indices.begin(),indices.end(),index-L);  <- Position at or below the first index
int num = it1 - it2;  <- number of indices with the letter i in the range

For other languages, there might be other methods of doing this, but since I am not very well versed in terms of different programming languages, I can only give a C++ example. Basically you want to subtract the larger index by the smaller index.

You might want to look up some other applications of binary search as well.