Georgrio Georgrio - 4 months ago 14
Java Question

WebResponse posting a null string

I am trying to post a xml from an html text area based from the curl command below

curl -X POST --data-urlencode 'xml=<hml>...</hml>' http://miring.b12x.org/validator/ValidateMiring/


Here is my code so far

@Produces("application/xml")
public String validate(@FormParam("xml") String xml) {

try {
Client client = Client.create();

WebResource webResource = client.resource("http://miring.b12x.org/validator/ValidateMiring/");

// POST method
//Posting null for some reason.
ClientResponse response = webResource.accept("application/xml").post(ClientResponse.class, xml);
// check response status code
if (response.getStatus() != 200) {
throw new RuntimeException("Failed : HTTP error code : " + response.getStatus());
}

// display response
String output = response.getEntity(String.class);
System.out.println("Output from Server .... ");
System.out.println(output + "\n");
return output;
} catch (Exception e) {
e.printStackTrace();
}

return "Oops";
}


When I run this with an XML that has been tested to work to the webapp I keep getting the null entry response.

I am not sure where to proceed

EDIT:
Primary question has been answered below. Bug appears with a + in the xml below is an example. Under the "consensus-sequence block is the "+" with strand. all other enumerations work (-,-1,1)

<?xml version="1.0" encoding="UTF-8"?>

<hml xmlns="http://schemas.nmdp.org/spec/hml/1.0.1"
xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
xsi:schemaLocation="http://schemas.nmdp.org/spec/hml/1.0.1 http://schemas.nmdp.org/spec/hml/1.0.1/hml-1.0.1.xsd"
version="1.0.1" >

<!--
MIRING Element 1.1 requires the inclusion of an hmlid.
hmlid can be reported in the form of an ISO Object Identifier (OID)
"root" represents a unique publically registered organization
"extension" is a unique document id managed by the reporting organization.
-->

<hmlid root="2.34.48.32" extension="HML.3245662"/>

<!--
MIRING Element 1.2 requires the inclusion of a reporting-center.
reporting-center identifies the organization sending the HML message.
"reporting-center-id" is a unique identifier of the sender.
"reporting-center-context" reports the context/naming authority of the identifier.
-->

<reporting-center reporting-center-id="567"/>
<sample id="4555-6677-8">
<typing gene-family="HLA" date="2015-01-13">

<!--
MIRING Element 3 requires the inclusion of Genotyping information.
The Genotype should include all pertinent Loci, as well as a Genotype in a standard format.
GLStrings can be included either as plain text, or as a reference to a publicly
available service, such as GL Service (gl.nmdp.org)
-->

<allele-assignment date="2015-07-28" allele-db="IMGT/HLA" allele-version="3.17.0">
<haploid locus="HLA-A" method="DNA" type="02:20:01"/>
<glstring>
HLA-A*02:20:01
</glstring>
</allele-assignment>
<typing-method>

<!--
MIRING Element 6 requires platform documentation. This could be a peer-reviewed publication,
or an identifier of a procedure on a publicly available resource, such as NCBI GTR
-->

<sbt-ngs locus="HLA-A"
test-id="HLA-A.Test.1234"
test-id-source="AcmeGenLabs">
<raw-reads uri="rawreads/read1.fastq.gz"
availability="public"
format="fastq"
paired="1"
pooled="1"
adapter-trimmed="1"
quality-trimmed="0"/>
</sbt-ngs>
</typing-method>
<consensus-sequence date="2015-01-13">

<!--
MIRING Element 2 requires the inclusion of Reference Context.
The location and identifiers of the reference sequence should be specified.
start and end attributes are 0-based, and refer to positions on the reference sequence.
-->

<reference-database availability="public" curated="true">
<reference-sequence
name="HLA-A reference"
id="Ref111"
start="945000"
end="946000"
accession="GL000123.4"
uri="http://AcmeGenReference/RefDB/GL000123.4"/>
</reference-database>

<!--
MIRING Element 4 requires the inclusion of a consensus sequence.
The start and end positions are 0-based, and refer to positions on the reference sequence (reference-sequence-id)
Multiple consensus-sequence-block elements can be included sequentially.
-->

<consensus-sequence-block reference-sequence-id="Ref111"
start="945532"
end="945832"
strand="+"
phase-set="1"
expected-copy-number="1"
continuity="true"
description="HLA-A Consensus Sequence 4.5.67">

<!--
A sequence can be reported as plain text, or as a pointer to an external reference,
or as variants from a reference sequence.
-->

<sequence>
CCCAGTTCTCACTCCCATTGGGTGTCGGGTTTCCAGAGAAGCCAATCAGTGTCGTCGCGGTCGCTGTTCTAAAGCCCGCACGCACCCACCGGGACTCAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCCAGACCTGGGCGGGTGAGTGCGGGGTCGGGAGGGAAACCGCCTCTGCGGGGAGAAGCAAGGGGCCCTCCTGGCGGGGGCGCAGGACCGGGGGAGCCGCGCCGGGACGAGGGTCGGGCAGGT
</sequence>

<!--
MIRING Element 5 requires the inclusion of any relevant sequence polymorphisms.
These represent variants from the reference sequence.
start and end attributes are 0-based, and refer to positions on the reference sequence.
You can see this variant at positions 10 - 15 on the sequence. (945542 - 945532 = 10)
-->

<variant id="0"
reference-bases="GTCATG"
alternate-bases="ACTCCC"
start="945542"
end="945548"
filter="pass"
quality-score="95">

<!--
The functional effects of variants can be reported using variant-effect.
They should use Sequence Ontology (SO) variant effect terms.
-->

<variant-effect term="missense_variant"/>
</variant>
</consensus-sequence-block>
</consensus-sequence>
</typing>
</sample>

<!--
Multiple samples can be included in a single message.
Each sample should have it's own reference-database(s) even if they are identical to other samples' references.
-->

<sample id="4555-6677-9">
<typing gene-family="HLA" date="2015-01-13">
<allele-assignment date="2015-07-28" allele-db="IMGT/HLA" allele-version="3.17.0">
<haploid locus="HLA-A" method="DNA" type="02:20:01"/>
<glstring>
HLA-A*02:01:01:01
</glstring>
</allele-assignment>
<typing-method>
<sbt-ngs locus="HLA-A"
test-id="HLA-A.Test.1234"
test-id-source="AcmeGenLabs">
<raw-reads uri="rawreads/read2.fastq.gz"
availability="public"
format="fastq"
paired="1"
pooled="1"
adapter-trimmed="1"
quality-trimmed="0"/>
</sbt-ngs>
</typing-method>
<consensus-sequence date="2015-01-13">
<reference-database availability="public" curated="true">
<reference-sequence
name="HLA-A reference"
id="Ref112"
start="945000"
end="946000"
accession="GL000123.4"
uri="http://AcmeGenReference/RefDB/GL000123.4"/>
</reference-database>
<consensus-sequence-block
reference-sequence-id="Ref112"
start="945532"
end="945832"
strand="+"
phase-set="1"
expected-copy-number="1"
continuity="true"
description="HLA-A Consensus Sequence 4.5.89">
<sequence>
CCCAGTTCTCGTCATGATTGGGTGTCGGGTTTCCAGAGAAGCCAATCAGTGTCGTCGCGGTCGCTGTTCTAAAGCCCGCACGCACCCACCGGGACTCAGATTCTCCCCAGACGCCGAGGATGGCCGTCATGGCGCCCCGAACCCTCCTCCTGCTACTCTCGGGGGCCCTGGCCCTGACCCAGACCTGGGCGGGTGAGTGCGGGGTCGGGAGGGAAACCGCCTCTGCGGGGAGAAGCAAGGGGCCCTCCTGGCGGGGGCGCAGGACCGGGGGAGCCGCGCCGGGACGAGGGTCGGGCAGGT
</sequence>
</consensus-sequence-block>
</consensus-sequence>
</typing>
</sample>

</hml>


Thank you

Answer

From the Javadoc of @FormParam (emphasis mine):

Binds the value(s) of a form parameter contained within a request entity body to a resource method parameter.

That is, if you invoke your validate() method e.g. from cURL like this

curl -X POST --data-urlencode 'xml=<hml>...</hml>' http://localhost:8080/validate

then the method parameter xml will be bound to the value <hml>...</hml> on which the ValidateMiring service returns a message XML is null. (at least to me).

If you, instead, prepend your method parameter with a prefix xml= before you post it to the actual web service, you should get a different result:

ClientResponse response = webResource.accept("application/xml").post(ClientResponse.class, "xml=" + xml);